Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing kguB gene

Properties
Regulog: PtxS - Ralstonia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: 2-ketogluconate utilization
Effector: 2-keto-D-gluconate
Phylum: Proteobacteria/beta
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia eutropha H16
Position: -79
Score: 6.24412
Sequence: TCCTGAAACCGGTTTCAAAA
Locus tag: H16_B1807
Name: kguS
Funciton: Putative 2-ketogluconate ABC transporter, substrate-binding component
Locus tag: H16_B1808
Name: kguC
Funciton: Putative 2-ketogluconate ABC transporter, permease component
Locus tag: H16_B1809
Name: kguB
Funciton: Putative 2-ketogluconate ABC transporter, permease component
Locus tag: H16_B1810
Name: kguA
Funciton: Putative 2-ketogluconate ABC transporter, ATPase component
Locus tag: H16_B1811
Name: kguE
Funciton: Epimerase KguE
Locus tag: H16_B1812
Name: kguK
Funciton: 2-ketogluconate kinase EC=2.7.1.13
Locus tag: H16_B1813
Name: kguD
Funciton: 2-ketogluconate-6-phosphate reductase EC=1.1.1.43
kguS-kguC-kguB-kguA-kguE-kguK-kguD -79 6.2 TCCTGAAACCGGTTTCAAAA H16_B1807