Orthologous regulated operons containing pulA2 gene

Properties
Regulog:	MalR - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Proteobacteria/gamma

Built upon 44 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Pseudoalteromonas atlantica T6c
Position: -95 Score: 5.44769 Sequence: TGATGAATACGTATGTAGGG Locus tag: Patl_2340 Name: amyA Funciton: Alpha-amylase (EC 3.2.1.1) Locus tag: Patl_2339 Name: pulA2 Funciton: Putative pullulanase (Alpha-dextrin endo-1,6-alpha-glucosidase) EC=3.2.1.41 Locus tag: Patl_2338 Name: aglA Funciton: Alpha-glucosidase (EC 3.2.1.20)
amyA-pulA2-aglA	-95	5.4	TGATGAATACGTATGTAGGG	Patl_2340

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --