Orthologous regulated operons containing malT gene

Properties
Regulog:	MalR - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Proteobacteria/gamma

Built upon 44 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Alteromonas macleodii 'Deep ecotype'
Position: -97 Score: 5.51473 Sequence: CGGTGAATACGTATGCAGAG Locus tag: MADE_01888 Name: susA Funciton: Neopullulanase (EC 3.2.1.135) Locus tag: MADE_01889 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: MADE_01890 Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
susA-malT-cgt	-97	5.5	CGGTGAATACGTATGCAGAG	MADE_01888
Colwellia psychrerythraea 34H
Position: -219 Score: 5.71084 Sequence: TAGTGAATACGTATGTAACA Locus tag: CPS_0975 Name: malT Funciton: Predicted maltose transporter MalT
malT	-219	5.7	TAGTGAATACGTATGTAACA	CPS_0975
Pseudoalteromonas atlantica T6c
Position: -213 Score: 5.93078 Sequence: ATCTGAATACGTATGCAAGC Locus tag: Patl_2187 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: Patl_2186 Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
malT-cgt	-213	5.9	ATCTGAATACGTATGCAAGC	Patl_2187

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --