Orthologous regulated operons containing RL4249 gene

Properties
Regulog:	RL4253 - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 11 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -244 Score: 6.11577 Sequence: CAATGAAAACGTTTTAAATT Position: -123 Score: 5.82936 Sequence: GGCTTATAACGTTTTAAATT Locus tag: RHE_CH03709 Name: RL4252 Funciton: sugar ABC transporter, substrate-binding component Locus tag: RHE_CH03708 Name: RL4251 Funciton: sugar ABC transporter, permease protein Locus tag: RHE_CH03707 Name: RL4250 Funciton: sugar ABC transporter, permease protein Locus tag: RHE_CH03706 Name: RL4249 Funciton: sugar ABC transporter, ATP-binding protein
RL4252-RL4251-RL4250-RL4249	-244	6.1	CAATGAAAACGTTTTAAATT	RHE_CH03709
	-123	5.8	GGCTTATAACGTTTTAAATT
Rhizobium leguminosarum bv. viciae 3841
Position: -245 Score: 6.05236 Sequence: GAATGGAAACGTTTTAAATT Position: -124 Score: 6.43867 Sequence: GATTTATAACGTTTTAAATT Locus tag: RL4252 Name: RL4252 Funciton: sugar ABC transporter, substrate-binding component Locus tag: RL4251 Name: RL4251 Funciton: sugar ABC transporter, permease protein Locus tag: RL4250 Name: RL4250 Funciton: sugar ABC transporter, permease protein Locus tag: RL4249 Name: RL4249 Funciton: sugar ABC transporter, ATP-binding protein
RL4252-RL4251-RL4250-RL4249	-245	6.1	GAATGGAAACGTTTTAAATT	RL4252
	-124	6.4	GATTTATAACGTTTTAAATT
Rhizobium sp. NGR234
Position: -129 Score: 6.21277 Sequence: GATTTGTAACGTTTTAAATT Locus tag: NGR_c33060 Name: RL4252 Funciton: sugar ABC transporter, substrate-binding component Locus tag: NGR_c33070 Name: RL4251 Funciton: sugar ABC transporter, permease protein Locus tag: NGR_c33080 Name: RL4250 Funciton: sugar ABC transporter, permease protein Locus tag: NGR_c33090 Name: RL4249 Funciton: sugar ABC transporter, ATP-binding protein Locus tag: NGR_c33110 Name: COG2303 Funciton: Choline dehydrogenase and related flavoproteins
RL4252-RL4251-RL4250-RL4249-COG2303	-129	6.2	GATTTGTAACGTTTTAAATT	NGR_c33060