Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing merE gene

Properties
Regulog: MerR - Ralstonia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Beta
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia eutropha JMP134
Position: -63
Score: 6.32826
Sequence: ACTCCGTACATGAGTACGGAAG
Locus tag: pJP4_52
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: pJP4_51
Name: merP
Funciton: Periplasmic mercury (+2) binding protein
Locus tag: pJP4_50
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
Locus tag: pJP4_49
Name: merD
Funciton: Mercuric resistance operon coregulator
Locus tag: pJP4_48
Name: merE
Funciton: Putative mercury resistance protein
merT-merP-merA-merD-merE -63 6.3 ACTCCGTACATGAGTACGGAAG pJP4_52
Ralstonia metallidurans CH34
Position: -63
Score: 6.32826
Sequence: ACTCCGTACATGAGTACGGAAG
Locus tag: RMe0107
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: RMe0106
Name: merP
Funciton: Periplasmic mercury (+2) binding protein
Locus tag: RMe0105
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
Locus tag: RMe0104
Name: merD
Funciton: Mercuric resistance operon coregulator
Locus tag: RMe0103
Name: merE
Funciton: Putative mercury resistance protein
merT-merP-merA-merD-merE -63 6.3 ACTCCGTACATGAGTACGGAAG RMe0107
© 2009-2020 RegPrecise