Orthologous regulated operons containing Atu4506 gene

Properties
Regulog:	PckR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Central carbohydrate metabolism
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 99 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -69 Score: 4.05797 Sequence: TGTTTAAATTGTTTAATTGC Locus tag: Atu4505 Name: pckR Funciton: Transcriptional regulator of phosphoenolpyruvate carboxykinase, LacI family Locus tag: Atu4506 Name: null Funciton: hypothetical protein Locus tag: Atu4507 Name: hpr Funciton: Glyoxylate reductase (EC 1.1.1.79) / Hydroxypyruvate reductase (EC 1.1.1.81)
pckR-Atu4506-hpr	-69	4.1	TGTTTAAATTGTTTAATTGC	Atu4505

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --