Orthologous regulated operons containing susC_Nan-5 gene

Properties
Regulog:	NanR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Sialic acid utilization; N-acetylglucosamine utilization
Effector:	N-acetylglucosamine; N-acetylneuraminic acid
Phylum:	Bacteroidetes

Built upon 59 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides dorei DSM 17855
Position: -163 Score: 4.79853 Sequence: GTTATAATAAAATATTTTTGTTT Position: -160 Score: 4.95787 Sequence: ATAATAAAATATTTTTGTTTATA Locus tag: BACDOR_01206 Name: susC_Nan-5 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BACDOR_01207 Name: susD_Nan-5 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers
susC_Nan-5-susD_Nan-5	-163	4.8	GTTATAATAAAATATTTTTGTTT	BACDOR_01206
	-160	5	ATAATAAAATATTTTTGTTTATA
Bacteroides fragilis NCTC 9343
Position: -39 Score: 5.29347 Sequence: ATTATAATTTTCTTTATTATTAA Locus tag: BF1719 Name: susC_Nan-5 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BF1720 Name: susD_Nan-5 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers
susC_Nan-5-susD_Nan-5	-39	5.3	ATTATAATTTTCTTTATTATTAA	BF1719
Bacteroides plebeius DSM 17135
Position: -267 Score: 5.20857 Sequence: TATATAAATAATATTTTTATCAT Position: -156 Score: 5.01146 Sequence: TTCATAAAATATTTTATCAAATA Locus tag: BACPLE_00590 Name: susC_Nan-5 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BACPLE_00589 Name: susD_Nan-5 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers
susC_Nan-5-susD_Nan-5	-267	5.2	TATATAAATAATATTTTTATCAT	BACPLE_00590
	-156	5	TTCATAAAATATTTTATCAAATA
Bacteroides vulgatus ATCC 8482
Position: -92 Score: 6.08724 Sequence: TTTTTAATAAATTATTTTATTAA Locus tag: BVU_2433 Name: fucA Funciton: Alpha-L-fucosidase (EC 3.2.1.51) Locus tag: BVU_2432 Name: susC_Nan-5 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BVU_2431 Name: susD_Nan-5 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers
fucA-susC_Nan-5-susD_Nan-5	-92	6.1	TTTTTAATAAATTATTTTATTAA	BVU_2433