Orthologous regulated operons containing Rcas_3899 gene

Properties
Regulog:	HcpR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Chloroflexi

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -116 Score: 6.47832 Sequence: ATCTTGCGCTAGCGCAACGA Locus tag: Cagg_2026 Name: Rcas_3898 Funciton: Cytochrome c family protein involved in nitrosative stress Locus tag: Cagg_2025 Name: Rcas_3899 Funciton: hypothetical protein involved in nitrosative stress
Rcas_3898-Rcas_3899	-116	6.5	ATCTTGCGCTAGCGCAACGA	Cagg_2026
Roseiflexus castenholzii DSM 13941
Position: -111 Score: 6.46055 Sequence: AACTTGCGCCAGCGCAACGA Locus tag: Rcas_3898 Name: Rcas_3898 Funciton: Cytochrome c family protein involved in nitrosative stress Locus tag: Rcas_3899 Name: Rcas_3899 Funciton: hypothetical protein involved in nitrosative stress
Rcas_3898-Rcas_3899	-111	6.5	AACTTGCGCCAGCGCAACGA	Rcas_3898
Roseiflexus sp. RS-1
Position: -105 Score: 6.46055 Sequence: AACTTGCGCCAGCGCAACGA Locus tag: RoseRS_0596 Name: Rcas_3898 Funciton: Cytochrome c family protein involved in nitrosative stress Locus tag: RoseRS_0597 Name: Rcas_3899 Funciton: hypothetical protein involved in nitrosative stress
Rcas_3898-Rcas_3899	-105	6.5	AACTTGCGCCAGCGCAACGA	RoseRS_0596

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --