Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing znuB gene

Properties
Regulog: Zur2 - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromobacterium violaceum ATCC 12472
Position: -137
Score: 6.18878
Sequence: GCGATGTTATACAGTAACATTAT
Locus tag: CV3068
Name: zur2
Funciton: Zinc uptake regulation protein Zur
Locus tag: CV3067
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: CV3066
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: CV3065
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: CV3064
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
zur2-yciC-znuC-znuB-znuA -137 6.2 GCGATGTTATACAGTAACATTAT CV3068
Laribacter hongkongensis HLHK9
Position: -47
Score: 5.56123
Sequence: GTTACGGCATAACATAACGAAAT
Locus tag: LHK_01344
Name: zur2
Funciton: Zinc uptake regulation protein Zur
Locus tag: LHK_01345
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: LHK_01346
Name: LHK_01346
Funciton: Hypothetical protein
Locus tag: LHK_01347
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: LHK_01348
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: LHK_01349
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
zur2-yciC-LHK_01346-znuC-znuB-znuA -47 5.6 GTTACGGCATAACATAACGAAAT LHK_01344
Neisseria meningitidis MC58
Position: -148
Score: 5.8021
Sequence: CAAACGTTATACAGTATCATATC
Locus tag: NMB0588
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: NMB0587
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC-znuB -148 5.8 CAAACGTTATACAGTATCATATC NMB0588