Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing BH1065 gene

Properties
Regulog: UxuR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucuronate utilization
Effector: Aldotetraouronic acid
Phylum: Firmicutes
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus halodurans C-125
Position: -186
Score: 6.10062
Sequence: CTACCATACTAGTATGATTA
Locus tag: BH1064
Name: BH1064
Funciton: Putative aldotetraouronic acid ABC transporter, substrate-binding protein
Locus tag: BH1065
Name: BH1065
Funciton: Putative aldotetraouronic acid ABC transporter, permease component
Locus tag: BH1066
Name: BH1066
Funciton: Putative aldotetraouronic acid ABC transporter, permease component
Locus tag: BH1067
Name: uxuB
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: BH1068
Name: xynB
Funciton: Beta-xylosidase
BH1064-BH1065-BH1066-uxuB-xynB -186 6.1 CTACCATACTAGTATGATTA BH1064
© 2009-2020 RegPrecise