Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing phnE2 gene

Properties
Regulog: PhnF - Rhizobiales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -35
Score: 6.3856
Sequence: TTGTCTATATCAATAGACAT
Locus tag: RHE_CH00167
Name: phnG
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
Locus tag: RHE_CH00166
Name: phnH
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
Locus tag: RHE_CH00165
Name: phnI
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
Locus tag: RHE_CH00164
Name: phnJ
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
Locus tag: RHE_CH00163
Name: phnK
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
Locus tag: RHE_CH00162
Name: phnL
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
Locus tag: RHE_CH00161
Name: phnO
Funciton: Aminoalkylphosphonic acid N-acetyltransferase
Locus tag: RHE_CH00160
Name: phnC
Funciton: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
Locus tag: RHE_CH00159
Name: phnD
Funciton: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
Locus tag: RHE_CH00158
Name: phnE2
Funciton: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
Locus tag: RHE_CH00157
Name: phnE
Funciton: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
Locus tag: RHE_CH00156
Name: rcsF
Funciton: Protein RcsF involved in phosphonates utilization
Locus tag: RHE_CH00155
Name: phnM
Funciton: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
Locus tag: RHE_CH00154
Name: phnN
Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
phnG-phnH-phnI-phnJ-phnK-phnL-phnO-phnC-phnD-phnE2-phnE-rcsF-phnM-phnN -35 6.4 TTGTCTATATCAATAGACAT RHE_CH00167