Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing phnM gene

Properties
Regulog: PhnF - Ralstonia
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria/beta
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia eutropha JMP134
Position: -243
Score: 6.7315
Sequence: CCTATACGTCTATACGTGTAGA
Locus tag: Reut_B4185
Name: phnF
Funciton: Transcriptional regulator for phosphonate utilization, GntR family
Locus tag: Reut_B4184
Name: phnM
Funciton: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
Locus tag: Reut_B4183
Name: rcsF
Funciton: Protein RcsF involved in phosphonates utilization
Locus tag: Reut_B4182
Name: phnN
Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
phnF-phnM-rcsF-phnN -243 6.7 CCTATACGTCTATACGTGTAGA Reut_B4185
Ralstonia metallidurans CH34
Position: -155
Score: 7.02863
Sequence: CCTATACGTCTATACGTTTAGA
Locus tag: Rmet_0767
Name: phnF
Funciton: Transcriptional regulator for phosphonate utilization, GntR family
Locus tag: Rmet_0768
Name: phnM
Funciton: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
Locus tag: Rmet_0769
Name: rcsF
Funciton: Protein RcsF involved in phosphonates utilization
Locus tag: Rmet_0770
Name: phnN
Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
phnF-phnM-rcsF-phnN -155 7 CCTATACGTCTATACGTTTAGA Rmet_0767