Orthologous regulated operons containing fadD2 gene

Properties
Regulog:	PsrA - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Phylum:	Proteobacteria/gamma

Built upon 19 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -138 Score: 5.265 Sequence: AATCATACGACTGTTTAAAT Locus tag: PE36_17450 Name: fadD2 Funciton: long-chain-fatty-acid--CoA ligase
fadD2	-138	5.3	AATCATACGACTGTTTAAAT	PE36_17450

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --