Orthologous regulated operons containing PE36_15065 gene

Properties
Regulog:	PsrA - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Phylum:	Proteobacteria/gamma

Built upon 19 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -55 Score: 5.66225 Sequence: ATTCAAACATATGTTTGAAA Locus tag: PE36_15065 Name: null Funciton: acetyl-CoA acetyltransferase
PE36_15065	-55	5.7	ATTCAAACATATGTTTGAAA	PE36_15065

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --