Orthologous regulated operons containing rrf1 gene

Properties
Regulog:	HmcR - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Phylum:	Proteobacteria/delta

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfovibrio vulgaris Hildenborough
Position: -210 Score: 5.82369 Sequence: TAGCATACCCCCGCAGTAGGATT Position: -185 Score: 5.54755 Sequence: TTCCATACTATACAGGTAGGGTA Locus tag: DVU0536 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: DVU0535 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: DVU0534 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: DVU0533 Name: hmcD Funciton: hmc operon protein 4 Locus tag: DVU0532 Name: hmcE Funciton: hmc operon protein 5 Locus tag: DVU0531 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: DVU0530 Name: rrf1 Funciton: response regulator, rrf1 protein Locus tag: DVU0529 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-rrf1-hmcR	-210	5.8	TAGCATACCCCCGCAGTAGGATT	DVU0536
	-185	5.5	TTCCATACTATACAGGTAGGGTA
Desulfovibrio vulgaris str. Miyazaki F
Position: -346 Score: 6.00332 Sequence: TCGCATACCCCTCCGGTAGGAAT Position: -321 Score: 5.915 Sequence: TTCCATACCCTAGAAGTAGGGTA Locus tag: DvMF_2598 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: DvMF_2597 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: DvMF_2596 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: DvMF_2595 Name: hmcD Funciton: hmc operon protein 4 Locus tag: DvMF_2594 Name: hmcE Funciton: hmc operon protein 5 Locus tag: DvMF_2593 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: DvMF_2592 Name: null Funciton: response regulator, rrf1 protein Locus tag: DvMF_2591 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-DvMF_2592-hmcR	-346	6	TCGCATACCCCTCCGGTAGGAAT	DvMF_2598
	-321	5.9	TTCCATACCCTAGAAGTAGGGTA