Orthologous regulated operons containing uvrD gene

Properties
Regulog:	LexA - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/beta

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thauera sp. MZ1T
Position: -20 Score: 5.37152 Sequence: GGCTGAATATACTTACAGCC Locus tag: Tmz1t_0548 Name: uvrD Funciton: ATP-dependent DNA helicase II
uvrD	-20	5.4	GGCTGAATATACTTACAGCC	Tmz1t_0548
Thiobacillus denitrificans
Position: -19 Score: 6.49066 Sequence: TACTGTATAAAAATACAGCA Locus tag: Tbd_1306 Name: uvrD Funciton: ATP-dependent DNA helicase II
uvrD	-19	6.5	TACTGTATAAAAATACAGCA	Tbd_1306

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --