Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Dace_2068 gene

Properties
Regulog: ModE - Desulfuromonadales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/delta
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfuromonas acetoxidans DSM 684
Position: -86
Score: 5.67411
Sequence: TTGCGTTGTATAGCGTGGCATATAGCGTAA
Locus tag: Dace_2070
Name: omp_mod
Funciton: predicted TonB-dependent outer memberane transporter for molybdate
Locus tag: Dace_2069
Name: Dace2069
Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
Locus tag: Dace_2068
Name: Dace_2068
Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
Locus tag: Dace_2067
Name: Dace_2067
Funciton: Core component Dace_2067 of predicted ECF transporter
omp_mod-Dace2069-Dace_2068-Dace_2067 -86 5.7 TTGCGTTGTATAGCGTGGCATATAGCGTAA Dace_2070
Pelobacter carbinolicus str. DSM 2380
Position: -107
Score: 5.26048
Sequence: GTTCGCTATATTCCGCGATTAACAACGTAT
Locus tag: Pcar_2396
Name: Dace2069
Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
Locus tag: Pcar_2395
Name: Dace_2068
Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
Locus tag: Pcar_2394
Name: Dace_2067
Funciton: Core component Dace_2067 of predicted ECF transporter
Dace2069-Dace_2068-Dace_2067 -107 5.3 GTTCGCTATATTCCGCGATTAACAACGTAT Pcar_2396
Pelobacter propionicus DSM 2379
Position: -107
Score: 5.65357
Sequence: CATCGTTATTACTAATACTATATAACTACG
Locus tag: Ppro_1541
Name: omp_mod
Funciton: predicted TonB-dependent outer memberane transporter for molybdate
Locus tag: Ppro_1540
Name: Dace2069
Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
Locus tag: Ppro_1539
Name: Dace_2068
Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
Locus tag: Ppro_1538
Name: Dace_2067
Funciton: Core component Dace_2067 of predicted ECF transporter
omp_mod-Dace2069-Dace_2068-Dace_2067 -107 5.7 CATCGTTATTACTAATACTATATAACTACG Ppro_1541