Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing modB gene

Properties
Regulog: ModE - Desulfuromonadales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/delta
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Geobacter lovleyi SZ
Position: -97
Score: 5.70744
Sequence: AAGCGTTATTTAGATCTATACATAACGTCA
Locus tag: Glov_0447
Name: modE
Funciton: Molybdate-responsive transcriptional regulator ModE
Locus tag: Glov_0448
Name: modD
Funciton: Molybdenum transport system protein ModD
Locus tag: Glov_0449
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Glov_0450
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Glov_0451
Name: modB
Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Glov_0452
Name: modC
Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
modE-modD-modA-modA-modB-modC -97 5.7 AAGCGTTATTTAGATCTATACATAACGTCA Glov_0447
Geobacter sulfurreducens PCA
Position: -160
Score: 5.75024
Sequence: TATCGTTATGTCATGAAGGTTATAGCGTTT
Locus tag: GSU2963
Name: modD
Funciton: Molybdenum transport system protein ModD
Locus tag: GSU2962
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: GSU2961
Name: modB
Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: GSU2960
Name: modC
Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
modD-modA-modB-modC -160 5.8 TATCGTTATGTCATGAAGGTTATAGCGTTT GSU2963