Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rbsC gene

Properties
Regulog: RbsR - Ralstonia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/beta
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia pickettii 12J
Position: -119
Score: 6.90418
Sequence: GTACGCAAACGTTTGCGAAG
Locus tag: Rpic_0882
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: Rpic_0881
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: Rpic_0880
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: Rpic_0879
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: Rpic_0878
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
rbsB-rbsA-rbsC-rbsR-rbsK -119 6.9 GTACGCAAACGTTTGCGAAG Rpic_0882
Ralstonia solanacearum GMI1000
Position: -108
Score: 6.72758
Sequence: ATACGCAAACGTTTGCGAGC
Locus tag: RS04260
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: RS04262
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: RS04264
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: RS04266
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: RS04269
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
rbsB-rbsA-rbsC-rbsR-rbsK -108 6.7 ATACGCAAACGTTTGCGAGC RS04260