Orthologous regulated operons containing trpR gene

Properties
Regulog:	TrpR - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Phylum:	Proteobacteria/gamma

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Marinomonas sp. MWYL1
Position: -45 Score: 4.25739 Sequence: TGTACTAGTACATGAATACA Locus tag: Mmwyl1_0659 Name: trpR Funciton: Trp operon repressor Locus tag: Mmwyl1_0660 Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27) Locus tag: Mmwyl1_0661 Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
trpR-trpE-trpG	-45	4.3	TGTACTAGTACATGAATACA	Mmwyl1_0659
Reinekea sp. MED297
Position: -19 Score: 4.50403 Sequence: TGTTATAGCATACTAGTACA Locus tag: MED297_18498 Name: trpR Funciton: Trp operon repressor Locus tag: MED297_18503 Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27) Locus tag: MED297_18508 Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
trpR-trpE-trpG	-19	4.5	TGTTATAGCATACTAGTACA	MED297_18498

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --