Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mlr6914 gene

Properties
Regulog: GlcC - Rhizobiales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: activator (repressor)
Biological process: Glycolate utilization
Effector: Glycolate
Phylum: Proteobacteria/gamma
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Mesorhizobium loti MAFF303099
Position: -156
Score: 5.16946
Sequence: AACTGGTCAAATTATTTATCCAATT
Locus tag: mlr6914
Name: mlr6914
Funciton: uncharacterized conserved membrane protein
mlr6914 -156 5.2 AACTGGTCAAATTATTTATCCAATT mlr6914
Mesorhizobium sp. BNC1
Position: -119
Score: 4.23926
Sequence: AACTGGTCAACTTATTTGTCCAATG
Locus tag: Meso_0365
Name: mlr6914
Funciton: uncharacterized conserved membrane protein
mlr6914 -119 4.2 AACTGGTCAACTTATTTGTCCAATG Meso_0365