Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF11736 gene

Properties
Regulog: Zur - Comamonadaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -50
Score: 6.83864
Sequence: ATAATGCAACACGATTGCATTAA
Locus tag: Aave_2813
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Aave_2812
Name: COG2884
Funciton: ABC transporter-related protein
Locus tag: Aave_2811
Name: COG4591
Funciton: Predicted ABC transport system, permease protein
Locus tag: Aave_2810
Name: Aave_2810
Funciton: Conserved hypothetical protein
Locus tag: Aave_2809
Name: PF11736
Funciton: Lipoprotein, putative
Locus tag: Aave_2808
Name: COG4531
Funciton: Predicted zinc-binding periplasmic protein
Locus tag: Aave_2807
Name: omr
Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
zur-COG2884-COG4591-Aave_2810-PF11736-COG4531-omr -50 6.8 ATAATGCAACACGATTGCATTAA Aave_2813
Polaromonas naphthalenivorans CJ2
Position: -77
Score: 6.50607
Sequence: ATAATGCAACCTGATTGCGATAG
Position: -45
Score: 6.63858
Sequence: GTAACGCAACTGAATTGCATTAA
Locus tag: Pnap_1145
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Pnap_1146
Name: COG2884
Funciton: ABC transporter-related protein
Locus tag: Pnap_1147
Name: COG4591
Funciton: Predicted ABC transport system, permease protein
Locus tag: Pnap_1148
Name: Aave_2810
Funciton: Conserved hypothetical protein
Locus tag: Pnap_1149
Name: PF11736
Funciton: Lipoprotein, putative
zur-COG2884-COG4591-Aave_2810-PF11736 -77 6.5 ATAATGCAACCTGATTGCGATAG Pnap_1145
-45 6.6 GTAACGCAACTGAATTGCATTAA
Polaromonas sp. JS666
Position: 27
Score: 6.95651
Sequence: ATAATGCAACTAGATTGCGTTAT
Locus tag: Bpro_1677
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Bpro_1678
Name: COG2884
Funciton: ABC transporter-related protein
Locus tag: Bpro_1679
Name: COG4591
Funciton: Predicted ABC transport system, permease protein
Locus tag: Bpro_1680
Name: Aave_2810
Funciton: Conserved hypothetical protein
Locus tag: Bpro_1681
Name: PF11736
Funciton: Lipoprotein, putative
Locus tag: Bpro_1682
Name: COG4531
Funciton: Predicted zinc-binding periplasmic protein
Locus tag: Bpro_1683
Name: omr
Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
zur-COG2884-COG4591-Aave_2810-PF11736-COG4531-omr 27 7 ATAATGCAACTAGATTGCGTTAT Bpro_1677