Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing yciC gene

Properties
Regulog: Zur - Burkholderia
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia sp. 383
Position: -8
Score: 6.0552
Sequence: GAAATGATATGTTATATCGTTGC
Locus tag: Bcep18194_B0316
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: Bcep18194_B0317
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
Locus tag: Bcep18194_B0318
Name: queD2
Funciton: 6-pyruvoyl-tetrahydropterin synthase-like
Locus tag: Bcep18194_B0319
Name: can2
Funciton: Carbonic anhydrase
Locus tag: Bcep18194_B0320
Name: pyrC2
Funciton: Dihydroorotase (EC 3.5.2.3)
yciC-folE2-queD2-can2-pyrC2 -8 6.1 GAAATGATATGTTATATCGTTGC Bcep18194_B0316
© 2009-2020 RegPrecise