Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing omr2 gene

Properties
Regulog: Zur - Burkholderia
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia xenovorans LB400
Position: -165
Score: 4.93616
Sequence: TGAATGTAATGATATAACATTCC
Locus tag: Bxe_B0900
Name: omr2
Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: Bxe_B0899
Name: exbB
Funciton: Biopolymer transport protein, MotA/TolQ/ExbB proton channel family protein
Locus tag: Bxe_B0898
Name: exbD
Funciton: Biopolymer transport protein ExbD/TolR
Locus tag: Bxe_B0897
Name: tonB
Funciton: Biopolymer transport protein, TonB protein
omr2-exbB-exbD-tonB -165 4.9 TGAATGTAATGATATAACATTCC Bxe_B0900
© 2009-2020 RegPrecise