Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fecD gene

Properties
Regulog: Zur - Burkholderia
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia pseudomallei K96243
Position: -303
Score: 5.84261
Sequence: CGGATGATATGTTATATCATCGT
Locus tag: BPSL2724
Name: omr1
Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: BPSL2723
Name: fecE
Funciton: Iron-siderophore ABC transport system, ATP-binding protein
Locus tag: BPSL2722
Name: fecC
Funciton: Iron-siderophore ABC transport system, substrate-binding protein
Locus tag: BPSL2721
Name: fecD
Funciton: Iron-siderophore ABC transport system, permease protein
omr1-fecE-fecC-fecD -303 5.8 CGGATGATATGTTATATCATCGT BPSL2724
Burkholderia sp. 383
Position: -209
Score: 5.31911
Sequence: GAATTGATATTTTGTATCATCTG
Locus tag: Bcep18194_A4489
Name: omr1
Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: Bcep18194_A4490
Name: fecE
Funciton: Iron-siderophore ABC transport system, ATP-binding protein
Locus tag: Bcep18194_A4491
Name: fecC
Funciton: Iron-siderophore ABC transport system, substrate-binding protein
Locus tag: Bcep18194_A4492
Name: fecD
Funciton: Iron-siderophore ABC transport system, permease protein
omr1-fecE-fecC-fecD -209 5.3 GAATTGATATTTTGTATCATCTG Bcep18194_A4489