Orthologous regulated operons containing fecE gene

Properties
Regulog:	Zur - Burkholderia
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria

Built upon 22 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Burkholderia mallei ATCC 23344
Position: -301 Score: 5.84261 Sequence: CGGATGATATGTTATATCATCGT Locus tag: BMA2036 Name: omr1 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter Locus tag: BMA2035 Name: fecE Funciton: Iron-siderophore ABC transport system, ATP-binding protein
omr1-fecE	-301	5.8	CGGATGATATGTTATATCATCGT	BMA2036
Burkholderia pseudomallei K96243
Position: -303 Score: 5.84261 Sequence: CGGATGATATGTTATATCATCGT Locus tag: BPSL2724 Name: omr1 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter Locus tag: BPSL2723 Name: fecE Funciton: Iron-siderophore ABC transport system, ATP-binding protein Locus tag: BPSL2722 Name: fecC Funciton: Iron-siderophore ABC transport system, substrate-binding protein Locus tag: BPSL2721 Name: fecD Funciton: Iron-siderophore ABC transport system, permease protein
omr1-fecE-fecC-fecD	-303	5.8	CGGATGATATGTTATATCATCGT	BPSL2724
Burkholderia sp. 383
Position: -209 Score: 5.31911 Sequence: GAATTGATATTTTGTATCATCTG Locus tag: Bcep18194_A4489 Name: omr1 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter Locus tag: Bcep18194_A4490 Name: fecE Funciton: Iron-siderophore ABC transport system, ATP-binding protein Locus tag: Bcep18194_A4491 Name: fecC Funciton: Iron-siderophore ABC transport system, substrate-binding protein Locus tag: Bcep18194_A4492 Name: fecD Funciton: Iron-siderophore ABC transport system, permease protein
omr1-fecE-fecC-fecD	-209	5.3	GAATTGATATTTTGTATCATCTG	Bcep18194_A4489