Orthologous regulated operons containing PFL_2463 gene

Properties
Regulog:	NrtR - Pseudomonadaceae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Proteobacteria/gamma

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Pseudomonas fluorescens Pf-5
Position: -156 Score: 5.46795 Sequence: AAAGTATATGTCATGTACTTT Position: -35 Score: 5.41151 Sequence: AAGGTACACGTCATGTACCAA Locus tag: PFL_2465 Name: nadD Funciton: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family Locus tag: PFL_2464 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: PFL_2463 Name: null Funciton: ADP-ribose pyrophosphatase (EC 3.6.1.13)
nadD-nrtR-PFL_2463	-156	5.5	AAAGTATATGTCATGTACTTT	PFL_2465
	-35	5.4	AAGGTACACGTCATGTACCAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --