Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mntB gene

Properties
Regulog: Zur - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 38 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium amycolatum SK46
Position: -143
Score: 4.36576
Sequence: GGTTGAAAATGCTTGTCGTTA
Locus tag: CORAM0001_0534
Name: mntA
Funciton: putative manganese ABC transporter, substrate-binding protein
Locus tag: CORAM0001_0535
Name: mntB
Funciton: putative manganese ABC transporter, ATP-binding protein
Locus tag: CORAM0001_0536
Name: mntC
Funciton: putative manganese ABC transporter, permease component
Locus tag: CORAM0001_0537
Name: mntD
Funciton: putative manganese ABC transporter, permease component 2
Locus tag: CORAM0001_0538
Name: mntR
Funciton: Manganese-dependent transcriptional regulator MntR
mntA-mntB-mntC-mntD-mntR -143 4.4 GGTTGAAAATGCTTGTCGTTA CORAM0001_0534
Corynebacterium urealyticum DSM 7109
Position: -128
Score: 5.2542
Sequence: TAATGGAAAACAGTGCCATTA
Locus tag: cur_1147
Name: mntA
Funciton: putative manganese ABC transporter, substrate-binding protein
Locus tag: cur_1146
Name: mntB
Funciton: putative manganese ABC transporter, ATP-binding protein
Locus tag: cur_1145
Name: mntC
Funciton: putative manganese ABC transporter, permease component
Locus tag: cur_1144
Name: mntD
Funciton: putative manganese ABC transporter, permease component 2
mntA-mntB-mntC-mntD -128 5.3 TAATGGAAAACAGTGCCATTA cur_1147