Orthologous regulated operons containing DIP0440 gene

Properties
Regulog:	Zur - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Actinobacteria

Built upon 38 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Corynebacterium diphtheriae NCTC 13129
Position: -69 Score: 4.93391 Sequence: TAATGAAAATGATTGTGATGT Locus tag: DIP0438 Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: DIP0439 Name: DIP0439 Funciton: Putative membrane protein Locus tag: DIP0440 Name: DIP0440 Funciton: putative ABC transport system, ATP-binding protein Locus tag: DIP0441 Name: DIP0441 Funciton: putative ABC transport system, permease protein
troA-DIP0439-DIP0440-DIP0441	-69	4.9	TAATGAAAATGATTGTGATGT	DIP0438
Corynebacterium jeikeium K411
Position: -75 Score: 4.37991 Sequence: GTTTGAAAATGGTTGCCACTT Position: -42 Score: 4.23974 Sequence: TAATGAAAACTAGACTCATTG Locus tag: jk1856 Name: sapD Funciton: putative surface-anchored protein Locus tag: jk1855 Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: jk1854 Name: DIP0439 Funciton: Putative membrane protein Locus tag: jk1853 Name: DIP0440 Funciton: putative ABC transport system, ATP-binding protein Locus tag: jk1852 Name: DIP0441 Funciton: putative ABC transport system, permease protein
sapD-troA-DIP0439-DIP0440-DIP0441	-75	4.4	GTTTGAAAATGGTTGCCACTT	jk1856
	-42	4.2	TAATGAAAACTAGACTCATTG
Corynebacterium urealyticum DSM 7109
Position: -160 Score: 5.05348 Sequence: AAAGGAAAACCATTGCCAATT Position: -103 Score: 5.03567 Sequence: ACTTGAAAATGGCTGTCATTA Locus tag: cur_0291 Name: sapD Funciton: putative surface-anchored protein Locus tag: cur_0292 Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: cur_0293 Name: DIP0440 Funciton: putative ABC transport system, ATP-binding protein Locus tag: cur_0294 Name: DIP0441 Funciton: putative ABC transport system, permease protein
sapD-troA-DIP0440-DIP0441	-160	5.1	AAAGGAAAACCATTGCCAATT	cur_0291
	-103	5	ACTTGAAAATGGCTGTCATTA