Orthologous regulated operons containing Pjdr2_3124 gene
| Regulog: | GltR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | repressor (activator) |
| Biological process: | unknown |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Paenibacillus sp. JDR-2 | ||||
|
Position: -101
Score: 5.43517 Sequence: AATATCTGAAAAAATGATATC
Locus tag: Pjdr2_3124
Name: Pjdr2_3124 Funciton: Major facilitator (MFS) superfamily protein |
||||
| Pjdr2_3124 | -101 | 5.4 | AATATCTGAAAAAATGATATC | Pjdr2_3124 |