Orthologous regulated operons containing GK3396 gene
| Regulog: | FadR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Palmitoyl-CoA; Oleoyl-CoA |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Geobacillus kaustophilus HTA426 | ||||
|
Position: -106
Score: 6.34699 Sequence: TTGACTGAATGCTCATTCAT
Locus tag: GK3398
Name: fadF Funciton: Fe-S oxidoreductase
Locus tag: GK3397
Name: mmgA Funciton: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Locus tag: GK3396
Name: GK3396 Funciton: Hypothetical protein
Locus tag: GK3395
Name: mmgB Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
||||
| fadF-mmgA-GK3396-mmgB | -106 | 6.3 | TTGACTGAATGCTCATTCAT | GK3398 |