Orthologous regulated operons containing ompF gene
| Regulog: | TyrR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | TyrR |
| Regulation mode: | activator (repressor) |
| Biological process: | Aromatic amino acid metabolism |
| Effector: | Tyrosine; Phenylalanine |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -76
Score: 4.96012 Sequence: ccGTAAATTTttATTgACAg
Locus tag: CKO_02137
Name: ompF Funciton: outer membrane porin F |
||||
| ompF | -76 | 5 | ccGTAAATTTttATTgACAg | CKO_02137 |
| Enterobacter sp. 638 | ||||
|
Position: -77
Score: 4.46896 Sequence: CCGGAAATATTTATTGACAG
Locus tag: Ent638_1448
Name: ompF Funciton: outer membrane porin F |
||||
| ompF | -77 | 4.5 | CCGGAAATATTTATTGACAG | Ent638_1448 |
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -75
Score: 4.96012 Sequence: CCGTAAATTTTTATTGACAG
Locus tag: b0929
Name: ompF Funciton: outer membrane porin F |
||||
| ompF | -75 | 5 | CCGTAAATTTTTATTGACAG | b0929 |
| Salmonella typhimurium LT2 | ||||
|
Position: -77
Score: 4.74639 Sequence: CTGTAAAGTTTTATTGACGG
Locus tag: STM0999
Name: ompF Funciton: outer membrane porin F |
||||
| ompF | -77 | 4.7 | CTGTAAAGTTTTATTGACGG | STM0999 |