Orthologous regulated operons containing rutG gene
| Regulog: | RutR - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acinetobacter sp. ADP1 | ||||
|
Position: -193
Score: 6.24061 Sequence: ATTTTACTAAATGGTAAAAA
Position: 15
Score: 4.27133 Sequence: TTTTGCCCCATCGGAAACAA
Locus tag: ACIAD0027
Name: rutA Funciton: Pyrimidine oxygenase
Locus tag: ACIAD0028
Name: rutB Funciton: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
Locus tag: ACIAD0029
Name: rutC Funciton: Aminoacrylate peracid reductase
Locus tag: ACIAD0030
Name: rutF Funciton: Flavin reductase
Locus tag: ACIAD0031
Name: rutG Funciton: Uracil permease |
||||
| rutA-rutB-rutC-rutF-rutG | -193 | 6.2 | ATTTTACTAAATGGTAAAAA | ACIAD0027 |
| 15 | 4.3 | TTTTGCCCCATCGGAAACAA | ||