Orthologous regulated operons containing rutC gene
Regulog: | RutR2 - Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Alteromonas macleodii 'Deep ecotype' | ||||
Position: -182
Score: 5.38566 Sequence: ATTGAACCAAAAGGTCCATT
Locus tag: MADE_00760
Name: rutA Funciton: Pyrimidine oxygenase
Locus tag: MADE_00761
Name: rutB Funciton: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
Locus tag: MADE_00762
Name: rutC Funciton: Aminoacrylate peracid reductase
Locus tag: MADE_00763
Name: rutD Funciton: Aminoacrylate hydrolase
Locus tag: MADE_00764
Name: rutE Funciton: 3-hydroxy propionic acid dehydrogenase
Locus tag: MADE_00765
Name: rutF Funciton: Flavin reductase
Locus tag: MADE_00766
Name: null Funciton: methylmalonate-semialdehyde dehydrogenase |
||||
rutA-rutB-rutC-rutD-rutE-rutF-MADE_00766 | -182 | 5.4 | ATTGAACCAAAAGGTCCATT | MADE_00760 |