Orthologous regulated operons containing codB gene
| Regulog: | RutR2 - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas aeruginosa PAO1 | ||||
|
Position: -99
Score: 6.98437 Sequence: TCCTGTCAGCGCTGACAGGA
Locus tag: PA0441
Name: pydB Funciton: Dihydropyrimidinase (EC 3.5.2.2)
Locus tag: PA0440
Name: pydX Funciton: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
Locus tag: PA0439
Name: pydA Funciton: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
Locus tag: PA0438
Name: codB Funciton: Cytosine permease
Locus tag: PA0437
Name: codA Funciton: Cytosine deaminase protein |
||||
| pydB-pydX-pydA-codB-codA | -99 | 7 | TCCTGTCAGCGCTGACAGGA | PA0441 |