Orthologous regulated operons containing gpt gene
| Regulog: | RutR - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Moritella sp. PE36 | ||||
|
Position: -146
Score: 4.74783 Sequence: ACTTGTCCCAAGGGTCAAGT
Locus tag: PE36_22205
Name: gpt Funciton: Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22) |
||||
| gpt | -146 | 4.7 | ACTTGTCCCAAGGGTCAAGT | PE36_22205 |