Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing xdhB gene

Properties
Regulog: RutR - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Moritella sp. PE36
Position: -118
Score: 5.11861
Sequence: ACTTGACTCGAGGGTCAGGT
Locus tag: PE36_18399
Name: xdhA
Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: PE36_18394
Name: xdhB
Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: PE36_18389
Name: xdhC
Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Locus tag: PE36_18384
Name: guaD
Funciton: Guanine deaminase (EC 3.5.4.3)
xdhA-xdhB-xdhC-guaD -118 5.1 ACTTGACTCGAGGGTCAGGT PE36_18399