Orthologous regulated operons containing pbuT gene

Properties
Regulog:	RutR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Phylum:	Proteobacteria/gamma

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -379 Score: 5.29469 Sequence: TATTGACCATCAAGTCAATT Locus tag: PE36_19145 Name: pbuT Funciton: Xanthine/uracil permease Locus tag: PE36_19150 Name: xpt Funciton: Xanthine phosphoribosyltransferase (EC 2.4.2.22)
pbuT-xpt	-379	5.3	TATTGACCATCAAGTCAATT	PE36_19145

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --