Orthologous regulated operons containing xdhB gene
| Regulog: | RutR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -74
Score: 5.61122 Sequence: AGTTGACTAAAAAGTCAGCT
Position: -47
Score: 5.92876 Sequence: TATTGACTCAAAGGTCAGAA
Locus tag: PBPRA2243
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: PBPRA2244
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: PBPRA2245
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Locus tag: PBPRA2246
Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) |
||||
| xdhA-xdhB-xdhC-guaD | -74 | 5.6 | AGTTGACTAAAAAGTCAGCT | PBPRA2243 |
| -47 | 5.9 | TATTGACTCAAAGGTCAGAA | ||
| Vibrio shilonii AK1 | ||||
|
Position: -86
Score: 4.93679 Sequence: AGTTGACCTCTTGGTCAAAT
Position: -58
Score: 6.03515 Sequence: TATTGACCCAAAGGTCAGAA
Locus tag: VSAK1_25090
Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Locus tag: VSAK1_25085
Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Locus tag: VSAK1_25080
Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
Locus tag: VSAK1_25075
Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) |
||||
| xdhA-xdhB-xdhC-guaD | -86 | 4.9 | AGTTGACCTCTTGGTCAAAT | VSAK1_25090 |
| -58 | 6 | TATTGACCCAAAGGTCAGAA | ||