Orthologous regulated operons containing rutR gene
| Regulog: | RutR - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acinetobacter sp. ADP1 | ||||
|
Position: -279
Score: 6.0176 Sequence: TTTTTACCATTTAGTAAAAT
Locus tag: ACIAD0026
Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
||||
| rutR | -279 | 6 | TTTTTACCATTTAGTAAAAT | ACIAD0026 |