Orthologous regulated operons containing rutC gene
| Regulog: | RutR4 - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas stutzeri A1501 | ||||
|
Position: -157
Score: 6.03842 Sequence: TTCGGACCAAATGGTCCACA
Locus tag: PST_3597
Name: rutA Funciton: Pyrimidine oxygenase
Locus tag: PST_3598
Name: rutB Funciton: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
Locus tag: PST_3599
Name: rutC Funciton: Aminoacrylate peracid reductase
Locus tag: PST_3600
Name: rutD Funciton: Aminoacrylate hydrolase
Locus tag: PST_3601
Name: rutE Funciton: 3-hydroxy propionic acid dehydrogenase
Locus tag: PST_3602
Name: rutF Funciton: Flavin reductase |
||||
| rutA-rutB-rutC-rutD-rutE-rutF | -157 | 6 | TTCGGACCAAATGGTCCACA | PST_3597 |
| Pseudomonas syringae pv. tomato str. DC3000 | ||||
|
Position: -68
Score: 5.79496 Sequence: TTCAGACCAAATGGTCTGCT
Locus tag: PSPTO1157
Name: rutA Funciton: Pyrimidine oxygenase
Locus tag: PSPTO1156
Name: rutB Funciton: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
Locus tag: PSPTO1155
Name: rutC Funciton: Aminoacrylate peracid reductase
Locus tag: PSPTO1154
Name: rutD Funciton: Aminoacrylate hydrolase
Locus tag: PSPTO1153
Name: rutF Funciton: Flavin reductase |
||||
| rutA-rutB-rutC-rutD-rutF | -68 | 5.8 | TTCAGACCAAATGGTCTGCT | PSPTO1157 |