Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rutB gene

Properties
Regulog: RutR4 - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas stutzeri A1501
Position: -157
Score: 6.03842
Sequence: TTCGGACCAAATGGTCCACA
Locus tag: PST_3597
Name: rutA
Funciton: Pyrimidine oxygenase
Locus tag: PST_3598
Name: rutB
Funciton: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
Locus tag: PST_3599
Name: rutC
Funciton: Aminoacrylate peracid reductase
Locus tag: PST_3600
Name: rutD
Funciton: Aminoacrylate hydrolase
Locus tag: PST_3601
Name: rutE
Funciton: 3-hydroxy propionic acid dehydrogenase
Locus tag: PST_3602
Name: rutF
Funciton: Flavin reductase
rutA-rutB-rutC-rutD-rutE-rutF -157 6 TTCGGACCAAATGGTCCACA PST_3597
Pseudomonas syringae pv. tomato str. DC3000
Position: -68
Score: 5.79496
Sequence: TTCAGACCAAATGGTCTGCT
Locus tag: PSPTO1157
Name: rutA
Funciton: Pyrimidine oxygenase
Locus tag: PSPTO1156
Name: rutB
Funciton: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
Locus tag: PSPTO1155
Name: rutC
Funciton: Aminoacrylate peracid reductase
Locus tag: PSPTO1154
Name: rutD
Funciton: Aminoacrylate hydrolase
Locus tag: PSPTO1153
Name: rutF
Funciton: Flavin reductase
rutA-rutB-rutC-rutD-rutF -68 5.8 TTCAGACCAAATGGTCTGCT PSPTO1157
© 2009-2020 RegPrecise