Orthologous regulated operons containing PF00903 gene
| Regulog: | SoxR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Enterobacter sp. 638 | ||||
|
Position: -64
Score: 6.34835 Sequence: ACCTCAAGTTAACTTTAGCT
Locus tag: Ent638_2697
Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase |
||||
| PF00903 | -64 | 6.3 | ACCTCAAGTTAACTTTAGCT | Ent638_2697 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -59
Score: 6.87237 Sequence: ATCTCAAGTTAACTTGAGGT
Locus tag: KPN_01861
Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase |
||||
| PF00903 | -59 | 6.9 | ATCTCAAGTTAACTTGAGGT | KPN_01861 |