Orthologous regulated operons containing sitA gene

Properties
Regulog:	MntR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Proteobacteria/gamma

Built upon 35 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -88 Score: 6.08658 Sequence: AAATATAGCCTGTGCTATGTTG Locus tag: CKO_00940 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: CKO_00939 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: CKO_00938 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: CKO_00937 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
sitA-sitB-sitC-sitD	-88	6.1	AAATATAGCCTGTGCTATGTTG	CKO_00940
Enterobacter sp. 638
Position: -75 Score: 6.2477 Sequence: AAATATAGCCTATGCTATATAA Position: -56 Score: 5.31523 Sequence: TAAGATAGCACAGGCTAATTTT Locus tag: Ent638_1111 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: Ent638_1112 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: Ent638_1113 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: Ent638_1114 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
sitA-sitB-sitC-sitD	-75	6.2	AAATATAGCCTATGCTATATAA	Ent638_1111
	-56	5.3	TAAGATAGCACAGGCTAATTTT
Erwinia amylovora ATCC 49946
Position: -73 Score: 5.60155 Sequence: GGATATAGCCTGTGCTATATGT Position: -54 Score: 4.92093 Sequence: TGTTATAGCAATTGCTATTTAG Locus tag: EAM_2087 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: EAM_2088 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: EAM_2089 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: EAM_2090 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
sitA-sitB-sitC-sitD	-73	5.6	GGATATAGCCTGTGCTATATGT	EAM_2087
	-54	4.9	TGTTATAGCAATTGCTATTTAG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -76 Score: 4.65539 Sequence: ATAAATAGCTTGTGCTATATAA Position: -57 Score: 5.71966 Sequence: TAACATAGCAATGGCTATAAAC Locus tag: KPN_03078 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: KPN_03079 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: KPN_03080 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: KPN_03081 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
sitA-sitB-sitC-sitD	-76	4.7	ATAAATAGCTTGTGCTATATAA	KPN_03078
	-57	5.7	TAACATAGCAATGGCTATAAAC
Salmonella typhimurium LT2
Position: -57 Score: 6.67954 Sequence: TAACATAGCAAAGGCTATATTC Locus tag: STM2861 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: STM2862 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: STM2863 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: STM2864 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
sitA-sitB-sitC-sitD	-57	6.7	TAACATAGCAAAGGCTATATTC	STM2861