Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing omr1 gene

Properties
Regulog: Zur - Enterobacteriales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 65 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -45
Score: 6.28965
Sequence: GATATGTTATGTTATAACATATC
Locus tag: CKO_00835
Name: omr1
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: CKO_00834
Name: znuX
Funciton: predicted zinc-related ABC transporter, periplasmic binding protein
Locus tag: CKO_00833
Name: znuW
Funciton: predicted zinc-related methyltransferase type 12
Locus tag: CKO_00832
Name: znuY
Funciton: predicted zinc-related ABC transporter, permease protein
omr1-znuX-znuW-znuY -45 6.3 GATATGTTATGTTATAACATATC CKO_00835
Serratia proteamaculans 568
Position: -85
Score: 5.9958
Sequence: TTATTGTTATGTTATAACATAAC
Position: -80
Score: 5.71076
Sequence: GTTATGTTATAACATAACAAAAA
Locus tag: Spro_1297
Name: omr1
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: Spro_1298
Name: znuX
Funciton: predicted zinc-related ABC transporter, periplasmic binding protein
Locus tag: Spro_1299
Name: znuW
Funciton: predicted zinc-related methyltransferase type 12
Locus tag: Spro_1300
Name: znuY
Funciton: predicted zinc-related ABC transporter, permease protein
Locus tag: Spro_1301
Name: null
Funciton: predicted zinc-related ABC transporter, ATP-binding protein
omr1-znuX-znuW-znuY-Spro_1301 -85 6 TTATTGTTATGTTATAACATAAC Spro_1297
-80 5.7 GTTATGTTATAACATAACAAAAA
© 2009-2020 RegPrecise