Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing can2 gene

Properties
Regulog: Zur - Enterobacteriales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 65 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -49
Score: 6.16125
Sequence: TTAATGTTATGTTATAACGTTTC
Locus tag: CKO_00932
Name: dksA2
Funciton: DnaK suppressor protein
Locus tag: CKO_00933
Name: yciA
Funciton: protein of unknown function DUF198
Locus tag: CKO_00934
Name: can2
Funciton: carbonic anhydrase
dksA2-yciA-can2 -49 6.2 TTAATGTTATGTTATAACGTTTC CKO_00932
Serratia proteamaculans 568
Position: -69
Score: 5.82403
Sequence: GATATGTTATAACATAACAAAAT
Locus tag: Spro_2628
Name: yciA
Funciton: protein of unknown function DUF198
Locus tag: Spro_2627
Name: can2
Funciton: carbonic anhydrase
Locus tag: Spro_2626
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciA-can2-yciC -69 5.8 GATATGTTATAACATAACAAAAT Spro_2628
© 2009-2020 RegPrecise