Orthologous regulated operons containing znuC2 gene

Properties
Regulog:	Zur - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/gamma

Built upon 65 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -141 Score: 6.14003 Sequence: TTATTGTTATGTTATAACATTTT Locus tag: CKO_04054 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: CKO_04053 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: CKO_04052 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
znuC2-znuB2-znuA2	-141	6.1	TTATTGTTATGTTATAACATTTT	CKO_04054
Enterobacter sp. 638
Position: -140 Score: 5.92211 Sequence: TTAGTGTTATGTTATAACATTAT Locus tag: Ent638_3178 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: Ent638_3177 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: Ent638_3176 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
znuC2-znuB2-znuA2	-140	5.9	TTAGTGTTATGTTATAACATTAT	Ent638_3178
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -123 Score: 6.4596 Sequence: GATATGTTATAATATAACAATTA Locus tag: ECA3756 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: ECA3757 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: ECA3758 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
znuC2-znuB2-znuA2	-123	6.5	GATATGTTATAATATAACAATTA	ECA3756
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -108 Score: 6.00479 Sequence: TTATTGTTATGTTATAACATTAA Locus tag: KPN_03035 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: KPN_03034 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: KPN_03033 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
znuC2-znuB2-znuA2	-108	6	TTATTGTTATGTTATAACATTAA	KPN_03035
Serratia proteamaculans 568
Position: -185 Score: 5.78697 Sequence: GTGATGTTATAATGTAACACTTA Locus tag: Spro_1121 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: Spro_1122 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: Spro_1123 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
znuC2-znuB2-znuA2	-185	5.8	GTGATGTTATAATGTAACACTTA	Spro_1121