Orthologous regulated operons containing hutC gene
| Regulog: | HutC - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -45
Score: 4.32863 Sequence: TTATATGTCTATACAATATA
Locus tag: Smlt3106
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Smlt3105
Name: hutC Funciton: Histidine utilization repressor |
||||
| hutF-hutC | -45 | 4.3 | TTATATGTCTATACAATATA | Smlt3106 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
|
Position: -56
Score: 4.38323 Sequence: TGATATGTATATACAATAGA
Locus tag: XCC1580
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: XCC1582
Name: hutC Funciton: Histidine utilization repressor |
||||
| hutF-hutC | -56 | 4.4 | TGATATGTATATACAATAGA | XCC1580 |