Orthologous regulated operons containing nrtY gene
| Regulog: | NrtR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium sp. BTAi1 | ||||
|
Position: -68
Score: 5.92953 Sequence: TTAGTTGTACTGTCCAACTTA
Position: -46
Score: 5.25584 Sequence: TTAGTTGTCGTGACACACTTA
Locus tag: BBta_5114
Name: nrtX Funciton: NrtR-regulated hypothetical OrfX, Band 7 protein domain
Locus tag: BBta_5115
Name: nrtY Funciton: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain |
||||
| nrtX-nrtY | -68 | 5.9 | TTAGTTGTACTGTCCAACTTA | BBta_5114 |
| -46 | 5.3 | TTAGTTGTCGTGACACACTTA | ||
| Rhizobium etli CFN 42 | ||||
|
Position: -103
Score: 5.87767 Sequence: TTAGTGTAAATCTTCAACTAA
Position: -81
Score: 5.69772 Sequence: TTAGTTGACATTTCTCACTAA
Locus tag: RHE_PF00026
Name: nrtX Funciton: NrtR-regulated hypothetical OrfX, Band 7 protein domain
Locus tag: RHE_PF00025
Name: nrtY Funciton: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain |
||||
| nrtX-nrtY | -103 | 5.9 | TTAGTGTAAATCTTCAACTAA | RHE_PF00026 |
| -81 | 5.7 | TTAGTTGACATTTCTCACTAA | ||