Orthologous regulated operons containing nrtY gene

Properties
Regulog:	NrtR - Comamonadaceae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Proteobacteria/beta

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Delftia acidovorans SPH-1
Position: -58 Score: 5.78196 Sequence: TAAGTTGCACTATGCAACCCA Position: -35 Score: 5.95447 Sequence: CGAGTTGTACAGAACAACTTA Locus tag: Daci_5758 Name: nrtX Funciton: NrtR-regulated hypothetical OrfX, Band 7 protein domain Locus tag: Daci_5759 Name: nrtY Funciton: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
nrtX-nrtY	-58	5.8	TAAGTTGCACTATGCAACCCA	Daci_5758
	-35	6	CGAGTTGTACAGAACAACTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --